Strona główna

Laboratorium w komputerze

Numer 10/2018
Model cząsteczki insuliny – w jej obrębie wyróżniono ­fragmenty zwijające się w spirale (pomarańczowe α-helisy). Model cząsteczki insuliny – w jej obrębie wyróżniono ­fragmenty zwijające się w spirale (pomarańczowe α-helisy). Wikipedia
Czasami zamiast probówek współczesnemu naukowcowi wystarcza szybki komputer.
Jednoniciowe tRNA zwija się w charakterystyczny „liść koniczyny”.Wikipedia Jednoniciowe tRNA zwija się w charakterystyczny „liść koniczyny”.

Analiza 1

Uruchom www.uniprot.org i w oknie wyszukiwania wpisz INSULIN. Znajdź i kliknij w pozycję P01308. Znajdź i kliknij w pozycję FASTA.

Wyjaśnienie: Baza danych UNIPROT (The UniProtConsortium. UniProt: the universal protein knowledgebase. Nucleic Acids Res. 2017 Jan 4;45(D1): D158-D169) zawiera informacje o białkach różnych organizmów, w tym o budowie ludzkiej insuliny, oznaczonej tutaj kodem P01308. FASTA jest uniwersalnym i prostym formatem zapisu sekwencji białek i kwasów nukleinowych. Po kliknięciu w przycisk zobaczysz, z ilu i z jakich reszt aminokwasowych zbudowana jest ludzka insulina. Stosowane jest nazewnictwo jednoliterowe (np. A to alanina), zgodne z wytycznymi IUPAC (Międzynarodowej Unii Chemii Czystej i Stosowanej, https://www.iupac.org/publications/pac/1984/pdf/5605x0595.pdf, s. 599).

Analiza 2

Uruchom www.uniprot.org i w oknie wyszukiwania wpisz INSULIN. Znajdź i zaznacz okienka wyboru przy pozycjach P01308 i P01315. Znajdź i kliknij w pozycję ALIGN (na górze tabeli) i poczekaj kilka minut, aż wykonane zostaną obliczenia. Zaznacz pozycję HELIX po lewej stronie.

Wyjaśnienie: Insulina jest ważnym hormonem, związanym z gospodarką węglowodanami. Jej wadliwe działanie może być jedną z przyczyn cukrzycy typu 1. Tak istotne białko zmienia się jednak w toku ewolucji, szczególnie te fragmenty, które są mniej krytyczne dla jego działania. Na stronie można znaleźć informację, że obie insuliny (ludzka i występująca u świń) są identyczne w ok. 85%. Funkcja uliniowienia sekwencji (ALIGN) pozwala na porównanie sekwencji dwóch lub więcej białek pochodzących z tego samego organizmu (np. hemoglobiny płodowej i hemoglobiny osoby dorosłej) lub z różnych źródeł. Obie sekwencje są wyświetlane jedna pod drugą w parach, a odpowiadające sobie reszty połączone są pionową kreską. Świńska insulina jest o dwie reszty krótsza niż ludzka, co w sekwencji zaznaczono [--]. Poniżej sekwencji symbolem [*] zaznaczone są identyczne reszty, a symbolem [·] reszty podobne (aminokwasy o podobnych własnościach, których podmiana najczęściej nie wpływa istotnie na funkcjonowanie białka). Własności reszt aminokwasowych można podświetlić, zaznaczając pozycje z listy AMINOACID PROPERTIES po lewej stronie. Zaznaczenie po lewej stronie pozycji HELIX powoduje podświetlenie fragmentów białka zwijających się w serpentyny, zwane helisami. Serpentyny te są charakterystycznym elementem białek, a ich ułożenie i wielkość mogą być ważne dla ich funkcji. Dlatego tworząc modele budowy białek, zwykle nie rozpisuje się wzorów wszystkich reszt aminokwasowych, ale właśnie struktury, takie jak helisy.

Analiza 3

Skopiuj sekwencję insuliny z analizy 1. Otwórz www.uniprot.org i kliknij BLAST. Wklej sekwencję w duże okno z napisem Protein sequence…. Kliknij RUN BLAST. Odczekaj kilka minut.

Wyjaśnienie: Tabela zawiera ok. 250 wyników uszeregowanych od najbardziej podobnych do zadanej sekwencji (na szczycie będzie człowiek, 100% identyczności, niżej małpy człekokształtne i inne zwierzęta). Funkcja BLAST porównuje (w podobny sposób jak w analizie 2) wprowadzoną sekwencję z innymi sekwencjami zgromadzonymi w bazie danych. Umożliwia ustalenie, z jakiego organizmu pochodzi sekwencja białka lub genu i w jakim stopniu jest identyczna z tymi zgromadzonymi w bazie. Niektóre sekwencje pozwalają na łatwą identyfikację roślin, zwierząt albo bakterii oraz ustalenie pokrewieństwa między nimi.

Analiza 4

Skopiuj sekwencję receptora insuliny ze strony www.uniprot.org/uniprot/P06213.fasta, a następnie wklej ją na stronie www.cbs.dtu.dk/services/TMHMM. Zaznacz opcję EXTENSIVE, WITH GRAPHICS i kliknij SUBMIT. Powtórz dla sekwencji insuliny.

Wyjaśnienie: Analiza wielu białek pozwala skojarzyć ich funkcje z występowaniem określonych sekwencji reszt aminokwasowych. Zatem możliwe jest także działanie w drugą stronę – na podstawie sekwencji można przewidywać pewne własności słabo zbadanych białek. Program określa prawdopodobieństwo (oś rzędnych wykresu) występowania w obrębie zadanej sekwencji kolejnych reszt aminokwasowych (oś odciętych) odpowiedzialnych za formowanie się helis (ta przestrzenna struktura przypomina cylinder), których zadaniem będzie zakotwiczanie białka w błonie. Ich obecność zaznaczona będzie czerwonymi pasami. Insulina nie zawiera takich helis, program przewiduje dwa takie obszary dla receptora insuliny (choć w rzeczywistości tylko jedna helisa kotwiczy to białko, drugi obszar jest zaangażowany w rozpoznawanie insuliny).

Analiza 5

Na stronie http://unafold.rna.albany.edu/? q=mfold/rna-folding-form wpisz w polu ENTER THE SEQUENCE TO BE FOLDED… sekwencję przykładowego RNA: AGAGAGAGAAAAAAAAACUCUCUCU, przewiń stronę do końca i kliknij FOLD RNA. Odczekaj chwilę i w sekcji STRUCTURE 1 kliknij PDF.

Wyjaśnienie: Reszty zasad w kwasach nukleinowych mogą oddziaływać ze sobą – adenina z tyminą (lub uracylem w RNA), a cytozyna z guaniną. W DNA oddziałują reszty w sąsiednich niciach, ale w jednoniciowym RNA mogą oddziaływać reszty w obrębie tej samej nici, co powoduje powstawanie skomplikowanych struktur, mogących mieć znaczenie biologiczne (część z nich odpowiada za katalityczne własności rybozymów, RNA zachowującego się jak enzym. Pętle są też ważne dla funkcjonowania tRNA, zaangażowanego w syntezę białek). Program szybko przewiduje, czy takie struktury mogą powstać. W tym przykładzie tworzy się bardzo prosta spinka z niewielką pętlą. Takie proste struktury kończą odczytywanie RNA kodującego dane białko podczas biosyntezy tegoż białka w komórkach bakterii.

dr hab. Renata Szymańska
Katedra Fizyki Medycznej i Biofizyki AGH

dr Paweł Jedynak
Zakład Fizjologii i Biochemii Roślin WBBiB UJ

***

Wiedza w pigułce

Żyjemy w świecie informacji – wytwarzamy je, przetwarzamy i gromadzimy. Nie inaczej postępują naukowcy, którzy produkują kolosalne ilości danych – wystarczy tylko wspomnieć o zakończonym w 2003 r. sekwencjonowaniu genomu człowieka, dzięki czemu wiadomo, że składa się on z ok. 20 tys. genów, a także trudnej do oszacowania liczby sekwencji o innym znaczeniu, np. regulatorowych. Poznano rolę jedynie części z nich. Aby ogarnąć te dane, potrzeba dobrze zaprojektowanych narzędzi tworzonych przez bioinformatyków i odpowiednich baz danych.

To właśnie praca bioinformatyków pozwala na porównywanie genomów ludzi i zwierząt (np. określono podobieństwo sekwencji kodujących człowieka i szympansa na ok. 98%) oraz roślin. Badania zmienności genetycznej pozwalają wnioskować o migracjach ludów, a nawet pokrewieństwie różnych gatunków.

Ale zadania bioinformatyków nie kończą się na analizie genów – na podstawie dostępnych danych budują komputerowe modele komórek lub ich fragmentów, analizują strukturę białek, kwasów nukleinowych, przebieg rozmaitych procesów komórkowych czy projektują nowe leki. Możliwe jest przewidywanie, czy dany związek chemiczny zostanie wbudowany w błonę komórkową, czy ułoży się w błonie prosto, czy pod kątem, czy wpłynie na jej płynność i czy zaburzy przenikanie przez nią innych substancji, np. tlenu. Siła współczesnej nauki tkwi w dzieleniu się wiedzą – dlatego wiele baz danych jest dostępnych nawet dla postronnych osób.

***

Uwaga!

Redakcja nie ponosi odpowiedzialności za ewentualne szkody powstałe wskutek doświadczeń.

01.10.2018 Numer 10/2018

Czytaj także

Reklama
Reklama

Ta strona do poprawnego działania wymaga włączenia mechanizmu "ciasteczek" w przeglądarce.

Powrót na stronę główną